ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A Fundação Eliseu Alves recebe as entregas de segunda à sexta nos horários de 8:00 às 17:00.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
10580/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 449/2019 Material de Escritório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Tripé
Descrição: Tripé fotográfico com cabeça estilo ballhead capacidade de carga de 4 kg. Marca Benro A650F com cabeça PU50 ou modelos similares.
1Unidade


10606/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 451/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Uréia
Descrição: Uréia, Fertilizante [principal elemento: nitrogênio] outros nomes químicos: uréia. Fórmula química:(NH2)2C0, aspecto físico: sólido em grãos perolado. Teor: 45% N saco com 25 kg.
3Unidade
Produto/Serviço: Superfosfato Simples
Descrição: Superfosfato simples granulado: adubo mineral com concentração de 17% a 21% de P2O5 (fósforo), além de aproximadamente 11% de Enxofre (S) e 18% de Cálcio (Ca). Saco de 50kg
3Unidade
Produto/Serviço: Cloreto de Potássio
Descrição: Cloreto de Potássio, fertilizante para uso agricola. saco de 20 Kg
3Unidade
Produto/Serviço: Fungicida Nativo
Descrição: Trifloxistrobina 100g/L+tebuconazol 200g/L, marca: Bayer, fungicida sistêmico. frasco de 1L
2Unidade
Produto/Serviço: Fipronil
Descrição: Inseticida Fipronil em pó, composição fipronil 0,023%. Inseticida para controle de cupins de solo, pulgas, carrapatos e formigas cortadeira. saco de 500g
5Unidade
Produto/Serviço: enxada
Descrição: Enxada larga, 2,5 libras com cabo qualidade igual ou superior a VONDER.
3Unidade
Produto/Serviço: bomba costal 20L
Descrição: Pulverizador manual costal 20 litros, qualidade igual ou superior a JACTO-XP20
2Unidade
Produto/Serviço: Abamectina
Descrição: Acaricida/inseticida: Abamectina, composição: 18g/l de abamectina, qualidade igual ou superior a Abamectin Nortox. frasco de 1L.
2Unidade
Produto/Serviço: Mirex
Descrição: Inseticida sulfluramida, composição: 3g/kg de sulfluramida, qualidade igual ou superior a Mirex-S da Atta kill. caixa com 40 unidades
1Caixa
Produto/Serviço: Bandejas para mudas
Descrição: Bandeja plástica contendo 50 células em formato quadrado com volume de 136 ml cada. Utilizada para o cultivo de mudas de Cana-de-Açúcar. Auxilia na produção de mudas mais uniformes e oferece melhor controle sanitário e nutricional garantindo maior produtividade. Características: - Dimensões do produto: A: 8cm C: 56cm L: 29cm; - Volume total: 6,8 litros; - Dimensões da célula: Altura: 8cm - Boca: 4,9cm - Fundo: 3,6cm; - Volume da célula: 136ml; - Quantidade de furos: 1; - Diâmetro do furo: 0,8cm. qualidade igual ou superior a nitriplan
200Unidade
Produto/Serviço: Substrato
Descrição: Destinado à germinação de sementes, enraizamento de estacas e alporques, e produção de mudas e plantas ESPECIFICAÇÕES TÉCNICAS: . Componentes: Turfa de sphagnum, Fibra de coco, Casca de arroz, Casca de Pinus, Vermiculita, gesso agrícola, carbonato de cálcio, magnésio, termofosfato magnesiano (Yoorin) e aditivos (fertilizantes) . Potencial hidrogenionico (pH): 6,2 . Condutividade elétrica (CE): 0,7 . Densidade: 150 kg/m³ . Capacidade de Retenção de Água – CRA: 100% . Reatividade - produto estável e inerte . Produto não tóxico . Natureza Física: sólida Qualidade igual ou superior a substrato Bioplant plus. saco de 25 kg.
50Unidade
Produto/Serviço: fertilizante NPK
Descrição: Suplementos de NPK foliares com microelementos quelatos. Formulação: 20-20-20. Qualidade igual ou superior a Plantafol. saco de 1kg.
5Unidade
Produto/Serviço: esponja
Descrição: Esponja (verde/amarela pct com 3 unidades). Ideal para limpeza de louças, azulejos, fogões e utensílios domésticos. Dupla face: Lado amarelo (espuma macia) para limpeza de superfícies delicadas. Lado verde (fibra abrasiva) para a limpeza mais dificil. Possui ação antibactérias. Não separa a parte amarela da verde
20Unidade
Produto/Serviço: Tesoura de Poda
Descrição: Tesoura de Poda. Tesoura para Poda com lamina de aço, Forjado, comprimento 20cm, cabo de plástico, peso: 190g. Qualidade igual ou superior a TS3124 trapp.
5Unidade
Produto/Serviço: Peneiras
Descrição: Peneiras. Peneira para areia madeira diâmetro 55cm Tipo de Material do Filtro: Aço, Diâmetro: 55 cm, Material do Suporte: Madeira, qualidade igual ou superior a Marca :Nove.54
2Unidade
Produto/Serviço: lâmpada
Descrição: LÂMPADA HALOGENA CLASSIC A ECO 42w 127 v E27 Kit 10 Unidades (qualidade) igual ou superior a OSRAM. caixa com 10 unidades, compativel com câmara de crescimento de plantas CONVIRON adaptis.
3Unidade


10626/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 456/2019 Material de Campo
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Adubo
Descrição: Adubo Superfosfato Simples
200Saco
Produto/Serviço: Adubo
Descrição: Adubo Ureia
100Saco
Produto/Serviço: Adubo
Descrição: Adubo Sulfato de Amônia
100Saco
Produto/Serviço: Adubo
Descrição: Adubo Cloreto de potássio
60Saco


10629/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 457/2019 Material de Campo
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Enxada rotativa
Descrição: Enxada rotativa compatível com a roçadeira Yanmar YBE335 com tubo com medida externa de 26 mm e eixo de 6,5 mm.
1Unidade


10630/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 458/2019 Material de Campo
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: HERBICIDA
Descrição: HERBICIDA 2,4-D. Um balde com 20 litros.
1Unidade
Produto/Serviço: HERBICIDA
Descrição: HERBICIDA Glifosato.
100Quilograma


10650/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 464/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Kit cDNA
Descrição: Thermo Scientific RevertAid H . Kit de sintese de cDNA. O kit inclui a Transcriptase Reversa Reversa de RevertAid H, que possui uma mutação pontual que elimina completamente a atividade da RNase H. Por conseguinte, não degrada o RNA em híbridos de RNA-DNA durante a síntese da primeira cadeia de cDNA. Kit com Alto rendimento de cDNA de primeira cadeia de tamanho completo até 13 kb. Temperaturas de reação aumentadas na faixa de 42 a 55 ° C. Fornecido com o inibidor de RNase RiboLock recombinante. Kit completo - oligo (dT) 18 e primers hexâmeros aleatórios incluídos no kit. kit para 100 reações. Qualidade igual ou superior a thermofisher scientific K1632.
3Unidade


10675/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 471/2019 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Impressora Multifuncional
Descrição: Impressora Multifuncional Epson Ecotank L575 Tanque de Tinta Colorida Sem Fio
1Unidade


12324/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 564/2019 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Computador Notebook
Descrição: Notebook Lenovo IdeaPad 330S Intel Core i5 8250U 15,6" 8GB HD 1 TB Radeon 535 Windows 10.
1Unidade
Produto/Serviço: Computador Notebook
Descrição: Notebook Dell i14-7460-A10 Intel Core i5 7200U 14" 8GB HD 1 TB GeForce 940MX Windows 10.
1Unidade


12326/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 565/2019 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: TABLET
Descrição: Tablet Samsung Galaxy Tab S4 T835 – Preto.
1Unidade
Produto/Serviço: Capa Protetora Com Teclado para Tablet Sansung Galaxy Tab S4 10.5 Preta
Descrição: Capa Protetora Com Teclado para Tablet Sansung Galaxy Tab S4 10.5 Preta
1Unidade


12342/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 568/2019 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ar Condicionado
Descrição: Ar Condicionado 6000 BTU, tipo de teto, instalado.
2Unidade


12343/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 569/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Ar Condicionado
Descrição: Ar Condicionado tipo/teto -42.000 BTU (220V). Obs: Valor do equipamento Instalado.
1Unidade
Produto/Serviço: Forro de gesso
Descrição: Forro de gesso acartonado. O preço corresponde ao produto instalado na Sala de Fenotipagem 2.
42Metro quadrado


15979/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 795/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: tubos de centrifugação
Descrição: TUBO DE CENTRIFUGAÇÃO TIPO FALCON DE 50mL, PP, Não-pirogênico, livre D-Nase/R-Nase e toxinas Os tubos de centrífuga da NEST são fabricados em polipropileno de alta transparência. A espessura da parede dos tubos de 50ML são uniformes e podem suportar centrifugações com velocidade de até 10.000 g (RCF). Com graduação em preto e branco e com superfície para marcação de amostras, Número de lote claros para rastreabilidade de lotes. TUBO DE CENTRIFUGAÇÃO TIPO FALCON DE 50mL, PP, Não-pirogênico, livre D-Nase/R-Nase e toxinas PACOTE COM 25 UNIDADES Os tubos de centrífuga da NEST são fabricados em polipropileno de alta transparência. A espessura da parede dos tubos de 50ML são uniformes e podem suportar centrifugações com velocidade de até 10.000 g (RCF). Características: Fabricado em polipropileno de alta transparência, Tampa abre e fecha facilmente (Easy-on/easy-off), Esterilizado por radiação gama, Não-pirogênico, livre D-Nase/R-Nase e toxinas, Suporta Temperaturas entre -80ºC a 120ºC, autoclavável por 20 minutos, Com graduação em preto e branco e com superfície para marcação de amostras, Número de lote claros para rastreabilidade de lotes. 30 pacotes com 25 unidades.
30Pacote
Produto/Serviço: D-manitol
Descrição: D-Manitol, com pureza igual ou maior a 98%, peso molecular: 182,17, CAS Number 69-65-8, qualidade igual ou superior a Sigma Aldrich M4125-1KG. 3 frascos de 1Kg.
3Frasco
Produto/Serviço: Solução de Acrilamida bisacrilamida 30%
Descrição: Solução de Acrilamida bisacrilamida 30%, para eletroforese de gel de proteína, com qualidade igual ou superior a A3574-100ML. 1 frasco de 100 mL
1Frasco


15981/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 796/2019 Serviços Especializados
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Síntese Oligonucleotídeos
Descrição: Síntese Oligonucleotídeos. A lista de Oligonucleotídeos está em anexo.
48Unidade


17205/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 863/2019 Material de Laboratório
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: manutenção
Descrição: Manutenção corretiva de SHAKER marca THERMO SCIENTIFIC, Modelo: SHKE6000-8CE, Serie: 300031891. Serviços a serem realizados: -Substituição da resistência (Fornecida pelo cliente) -Limpeza da unidade -Limpeza geral -Testes de funcionamento Garantia do serviço 120 dias
1Unidade


17575/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 881/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Geladeira
Descrição: Geladeira Brastemp branca de no minimo 500 litros frosfree e capacidade de armazenamento de 500 litros.
1Unidade


17576/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 882/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Geladeira
Descrição: Geladeira BRASTEMP BRANCA DE NO MINIMO 500 LITROS FROSFREE E CAPACIDADE DE ARMAZENAMENTO DE 500 LITROS
1Unidade


18017/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 923/2019 Serviços Especializados
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviços de desenvolvimento de base de dados
Descrição: Realizar Serviços de desenvolvimento de base de dados.
1Unidade


20210/2019
31/07/2019 00:00:00
Cotação (Compra Direta)
CD 1014/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Síntese Oligonucleotídeos
Descrição: Síntese Oligonucleotídeos: Sintese de primers em escala de 25nmoles e dessalinizados (DST) como forma de purificação: F-1 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttGCGTtggagtgagtacggtgtgc F-2 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttGTAGtggagtgagtacggtgtgc F-3 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttACGCtggagtgagtacggtgtgc F-4 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttCTCGtggagtgagtacggtgtgc F-5 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttGCTCtggagtgagtacggtgtgc F-6 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttAGTCtggagtgagtacggtgtgc F-7 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttCGACtggagtgagtacggtgtgc F-8 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttGATGtggagtgagtacggtgtgc F-9 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttATACtggagtgagtacggtgtgc F-10 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttCACAtggagtgagtacggtgtgc F-11 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttGTGCtggagtgagtacggtgtgc F-12 ACTCTTTCCCTACACGACGCTCTTCCGATCTgcttACTAtggagtgagtacggtgtgc 2P-F AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT R-A GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtGCGTtgagttggatgctggatgg R-B GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtGTAGtgagttggatgctggatgg R-C GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtACGCtgagttggatgctggatgg R-D GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtCTCGtgagttggatgctggatgg R-E GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtGCTCtgagttggatgctggatgg R-F GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtAGTCtgagttggatgctggatgg R-G GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtCGACtgagttggatgctggatgg R-H GACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgtGATGtgagttggatgctggatgg 2P-R CAAGCAGAAGACGGCATACGAGATCGCTGATCGTGACTGGAGTTCAGACGTGTGCTCTT SvBAHD5-F ggagtgagtacggtgtgcGCCCACCGTAACCAAGTC SvBAHD5-R ACTCGATCTCAGGCTCTCCgagttggatgctggatgg SvBAHD1-F ggagtgagtacggtgtgcGTCGAGCCGCACAACAC SvBAHD1-R GGGCCCGGCTTGATGTTgagttggatgctggatgg SvBAHD1-2F ggagtgagtacggtgtgcAGGACCTCGTCCCTTACC SvBAHD1-2R CGGCTTGATGTTTGGGTTGgagttggatgctggatgg
1494Unidade


20432/2019
21/07/2019 16:00:00
Cotação (Compra Direta)
CD 1023/2019 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Computador Notebook
Descrição: Computador Notebook com as seguintes características: Tela de 14 polegadas; Sitema operacional Windows 10; cache de 3MB, Chipset integrado; Memória RAM de 4GB; HD com capacidade de 1 TB; Placa de som com 2 alto-falantes (1,5W) com certificação Dolby Audio; Placa de rede 10/1000M; Conexões HDMI e USB; Leitor de cartões 4 em 1 (SD, SDHC, SDXC e MMC); teclado comum; Câmera integrada; IMPORTANTE: Softwares inclusos Microsoft Office Home & Student 2019 - Versão Perpétua. Preferencialmente marca Samsung ou HP (Lenovo, Multilaser e Dell preferencialmente não)
11Unidade


20456/2019
21/07/2019 16:00:00
Cotação (Compra Direta)
CD 1024/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Pulverizador a base de CO2
Descrição: Pulverizador de pesquisa completo composto por: 2 (dois) cilindros de alumínio com capacidade para 2 kg de CO2; Regulador de Pressão; Apoio Costal; Manômetro de 0 a 100 psi; Gatilho; Pescador com válvula de segurança que abre a 60psi; sistema antigotejo e engate rápido; Barra de pulverização com 4 bicos espaçados de 50 cm.
1Unidade
Produto/Serviço: Pulverizador costal elétrico
Descrição: Pulverizador costal elétrico a bateria, modelo Jacto DJB-20, 20 L
1Unidade
Produto/Serviço: Roçadeira
Descrição: Roçadeira Husqvarna 143RII 41,5cc; 20,01HP
1Unidade


20470/2019
21/07/2019 16:00:00
Cotação (Compra Direta)
CD 1026/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: CYPRESS 400EC/ POLO 500SC
Descrição: CYPRESS 400EC/ POLO 500SC
1Unidade


20473/2019
21/07/2019 16:00:00
Cotação (Compra Direta)
CD 1028/2019 Serviços Gerais
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviço de organização de reuniões e capacitação (convites, contatos, divulgação,etc)
Descrição: Contratação de serviço de organização de reuniões e capacitação (convites, contatos, divulgação,etc)
1Unidade


20475/2019
21/07/2019 16:00:00
Cotação (Compra Direta)
CD 1030/2019 Serviços Gerais
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Serviço de treinamento em R
Descrição: Contratação de treinamento em R.
1Unidade


20483/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1033/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Álcool
Descrição: Álcool 96% GL, comercial Caixa com 12 litros
60Caixa


20492/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1034/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: enzima CPFI
Descrição: Cas12a (Cpf1) Nuclease Recombinante de Acidaminococcus sp. BV3L6 Cas12a (Cpf1), purificada a partir de uma estirpe de E. coli que expressa Cas12a. Contém sequência de localização nuclear (NLS) e etiqueta 6-His C-terminal. Fornecido em solução a 10 µg / µl. 100 µg de nuclease Cas12a = 633 pmol.Produto de qualidade igual ou superior a IDT, Alt-R® A.s. Cas12a (Cpf1) V3, 500 µg, cat: 1081069
2Unidade
Produto/Serviço: enzima Cas9
Descrição: Cas9 Proteína de Streptococcus pyogenes, recombinante, expressa em E. coli, 1X NLS. Componentes: Cada kit consiste em: • um frasco para injetáveis ??de proteína recombinante Cas9 • um frasco contendo 1 mL de tampão de diluição 1 × • um frasco contendo 1 mL de água sem nuclease com glicerol Produto de qualidade igual ou superior a CAS9PROT-2X250UG da Sigma Aldrich.
2Unidade


20499/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1035/2019 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Computador Notebook
Descrição: Computador Notebook tela 15,6" LED, 16GB RAM DDR4 2400 MHz, Processador Intel Core I7 2.9 GHz, Placa de vídeo NVIDIA Maxwell M520M 4GB, bateria 4 células (66 WHr), 4 portas USB, HDMI 1.4, Wireless Intel 8265 Dual Band AC (2x2), Bluetooth 4.1, Ethernet (RJ-45), leitor de impressão digital, Gabinete Fibra de vidro reforçada com plástico
1Unidade


20508/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1036/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Estereomicroscopio binocular
Descrição: Estereomicroscópio com faixa de aumento contínuos de 13x à 56x. Oculares fixas de 16x/15mm, ajuste interpupilar de 50-75mm e distância de trabalho de 100mm. Sistema de iluminação integrado LED, temperatura de cor de iluminação incidente de 6.500K e iluminação transmitida de 4.500K. Sistema de desligamento automático após 120 minutos de não utilização. Fonte de alimentação integrada e automática - 100V à 240V/50-60Hz, cabo de ligação e capa de proteção.
1Unidade


20587/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1039/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: marcador de proteina
Descrição: Amersham ECL Rainbow marker full range, marcador de proteína para geis de SDS-PAGE. Possui 10 bandas com 6 diferentes cores. As bandas vão de 12kD a 225KD. Produto com qualidade igual ou superior a sigma aldrich GERPN800E
1Unidade
Produto/Serviço: DL-Dithiothreitol
Descrição: DL-Dithiothreitol, CAS Number 3483-12-3, Linear Formula HSCH2CH(OH)CH(OH)CH2SH, peso molecular 154.25, 98% de pureza, qualidade igual ou superior a Sigma Aldrich, D0632
1Unidade


20592/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1040/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: álcool etílico para limpeza
Descrição: Álcool etílico comercial para limpeza em geral, hidratado 92,8 INPM (Álcool 96° GL)
120Unidade
Produto/Serviço: Papel Filtro Qualitativo
Descrição: Papel Filtro Qualitativo: PAPEL FILTRO QUALITATIVO 12,5 CM, 80G, pacote com 100 unidades
30Pacote
Produto/Serviço: papel toalha
Descrição: Papel Toalha Interfolha 2 dobras, branco, 19X20 caixa com 1000 unidades
30Caixa
Produto/Serviço: hipoclorito de sódio 2 a 2,5%
Descrição: Hipoclorito de sódio, hidróxido de sódio, cloreto, teor cloro ativo varia de 2 a 2,50%, classe corrosivo classe 8, número risco 85, risco saúde 3, corrosividade 1, peso molecular cloro 74,50, densidade de 1,20 a 1, cor amarela esverdeada bastante fraca, aplicação lavagem e alvejante de roupas, banheiras, pias,, tipo comum, frasco de 5 L
10Unidade


20599/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1042/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Frasco
Descrição: Frasco confeccionado em vidro borossilicato 3.3 transparente, com dispositivo anti-gotas (anel de vedação) e tampa de rosca azul. Volume máximo 250 mL
10Unidade
Produto/Serviço: Frasco
Descrição: Frasco confeccionado em vidro borossilicato 3.3 transparente, com dispositivo anti-gotas (anel de vedação) e tampa de rosca azul. Volume máximo 500 mL
10Unidade
Produto/Serviço: Frasco
Descrição: Frasco confeccionado em vidro borossilicato 3.3 transparente, com dispositivo anti-gotas (anel de vedação) e tampa de rosca azul. Volume máximo 50 mL
10Unidade


20605/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1044/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Microtubos
Descrição: Microtubos: Microtubos de centrifugação de 2,0 mL, tampa lisa chata, não-estéril, cor natural, com tampa do tipo “snaplock” (“tampa de pressão”) que permanecem fechadas durante fervura e a uma centrifugação de 20.000 RCF; Com graduação precisa e paredes ultra transparente (“MaxyClear”) para facilitar a visualização das amostras; Fundo cônico; A identificação das amostras pode ser feita na tampa (lisa) ou na lateral do microtubo (superfície fosca); Livres de DNase, RNase e pirogênios; Autoclaváveis a 121°C por 15 minutos. Qualidade igual ou superior a AXYGEN. 10 pacotes com 500 unidades
10Unidade
Produto/Serviço: Caixa de Fibra de Papelão
Descrição: Caixas Moldadas em fibra de papelão, revestidas com papel especial branco, para armazenamento de tubos Falcon em geladeira e freezer. Suportam temperaturas de até -80ºC. Possuem tampa de encaixe e apresentam identificação alfa-numérica das divisórias na tampa. Acomoda 36 tubos tipo Falcon de 15 ml. 1 pacote com 10 unidades
1Unidade
Produto/Serviço: caixa de fibra de papalão
Descrição: Caixas Moldadas em fibra de papelão, revestidas com papel especial branco, para armazenamento de tubos Falcon em geladeira e freezer. Suportam temperaturas de até -80ºC. Possuem tampa de encaixe e apresentam identificação alfa-numérica das divisórias na tampa.Acomoda 16 tubos tipo Falcon de 50 ml. 1 pacote com 10 unidades.
1Unidade
Produto/Serviço: tubos de centrifugação
Descrição: TUBO DE CENTRIFUGAÇÃO TIPO FALCON DE 50mL, PP, Não-pirogênico, livre D-Nase/R-Nase e toxinas Os tubos de centrífuga da NEST são fabricados em polipropileno de alta transparência. A espessura da parede dos tubos de 50ML são uniformes e podem suportar centrifugações com velocidade de até 10.000 g (RCF). Com graduação em preto e branco e com superfície para marcação de amostras, Número de lote claros para rastreabilidade de lotes. TUBO DE CENTRIFUGAÇÃO TIPO FALCON DE 50mL, PP, Não-pirogênico, livre D-Nase/R-Nase e toxinas PACOTE COM 25 UNIDADES Os tubos de centrífuga da NEST são fabricados em polipropileno de alta transparência. A espessura da parede dos tubos de 50ML são uniformes e podem suportar centrifugações com velocidade de até 10.000 g (RCF). Características: Fabricado em polipropileno de alta transparência, Tampa abre e fecha facilmente (Easy-on/easy-off), Esterilizado por radiação gama, Não-pirogênico, livre D-Nase/R-Nase e toxinas, Suporta Temperaturas entre -80ºC a 120ºC, autoclavável por 20 minutos, Com graduação em preto e branco e com superfície para marcação de amostras, Número de lote claros para rastreabilidade de lotes. 30 pacotes com 25 unidades
30Pacote
Produto/Serviço: tubos de centrifugação
Descrição: TUBO DE CENTRIFUGAÇÃO TIPO FALCON DE 15mL, PP São fabricados em polipropileno de alta transparência. A espessura da parede dos tubos de 50ML são uniformes e podem suportar centrifugações com velocidade de até 10.000 g (RCF). Os tubos de 15ML podem suportar centrifugações com velocidade de até 6.000 g (RCF). As tampas são projetadas com uma dupla prova de vazamento e mais fácil de fechar. Os tubos são projetados para termperaturas de -80ºC a 120ºC. A impressão silk não apaga após o processamento da autoclave. Com escala precisas de 1 em 1 ml. Características: Fabricado em polipropileno de alta transparência, Tampa abre e fecha facilmente (Easy-on/easy-off) Esterilizado por radiação gama, Não-pirogênico, livre D-Nase/R-Nase e toxinas, Suporta Temperaturas entre -80ºC a 120ºC, autoclavável por 20 minutos, Com graduação em preto e branco e com superfície para marcação de amostras, Número de lote claros para rastreabilidade de lotes. 30 pacotes com 25 unidades
30Pacote
Produto/Serviço: caixa de polipropileno para microtubos
Descrição: Caixa para armazenamento de 100 microtubos criogênicos/ microtubo de 1,5 ou 2 mL, polipropileno autoclavável, tampa com dobradiça, Resistente a temperaturas entre -80°C e 121°C; Cores sortidas: azul, amarelo, laranja, roxo e verde; Tampa dobradiça de fácil abertura; Autoclavável (121°C, 15 psi, 30 min.); Dimensões: 141 x 151 x 57 mm; Identificação alfanumérica;
20Unidade


20609/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1045/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Provetas
Descrição: Proveta de vidro com base de vidro, graduada, volume 10 mL.
5Unidade
Produto/Serviço: Provetas
Descrição: Proveta de vidro com base de vidro, graduada, volume 25mL.
5Unidade
Produto/Serviço: Provetas
Descrição: Proveta de vidro com base de vidro, graduada, volume 50 mL
5Unidade
Produto/Serviço: Provetas
Descrição: Proveta de vidro com base de vidro, graduada, volume 100 mL
5Unidade
Produto/Serviço: Provetas
Descrição: Proveta de vidro com base de vidro, graduada, volume 250 mL
5Unidade
Produto/Serviço: Provetas
Descrição: Proveta de vidro com base de vidro, graduada, volume 500 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Exceto os copos de 5 e 10 mL Forma baixa. Volume 5 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Exceto os copos de 5 e 10 mL Forma baixa. Volume 10 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Exceto os copos de 5 e 10 mL Forma baixa. Volume 25 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Exceto os copos de 5 e 10 mL Forma baixa. Volume 50 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Forma baixa. Volume100 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Forma baixa. Volume 150 mL
5Unidade
Produto/Serviço: bequer
Descrição: bequer de vidro suporta temperatura de aproximadamente 500ºC, temperatura ideal de trabalho em Laboratório até 360ºC sem choque térmico, Com Bico Vertedor, Vidro borosilicato 3.3, Graduado - Exceto os copos de 5 e 10 mL Forma baixa. Volume 300 mL
5Unidade
Produto/Serviço: Lâmina para bisturi
Descrição: Lâmina para bisturi: bisturi 11, Confeccionadas em aço carbono; - Esterilizadas por radiação de Cobalto; - Grande resistência à corrosão e perda de afiação; - Embaladas individualmente em material aluminizado; - Mantem-se estéreis preservando a integridade asséptica do produto; - Apresentação: caixa com 100 unidades. 20 caixas com 100 unidades
20Caixa
Produto/Serviço: Lâmina para bisturi
Descrição: Lâmina para bisturi: bisturi 21, Confeccionadas em aço carbono; - Esterilizadas por radiação de Cobalto; - Grande resistência à corrosão e perda de afiação; - Embaladas individualmente em material aluminizado; - Mantem-se estéreis preservando a integridade asséptica do produto; - Apresentação: caixa com 100 unidades. 10 caixas com 100 unidades
10Caixa
Produto/Serviço: Lâmina para bisturi
Descrição: Lâmina para bisturi: bisturi 24, Confeccionadas em aço carbono; - Esterilizadas por radiação de Cobalto; - Grande resistência à corrosão e perda de afiação; - Embaladas individualmente em material aluminizado; - Mantem-se estéreis preservando a integridade asséptica do produto; - Apresentação: caixa com 100 unidades. 10 caixas com 100 unidades
10Caixa


20618/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1046/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Tris base COD: 10708976001
Descrição: Tris base COD: 10708976001 Estimado para envio em 10.07.19 SIGMA-ALDRICH
2Frasco
Produto/Serviço: Sacarose BioXtra
Descrição: Sacarose BioXtra, =99.5% (GC) COD: S7903-1KG SIGMA-ALDRICH
2Frasco
Produto/Serviço: Murashige e Skoog Basal Medium pó, cultura de células vegetais
Descrição: Murashige e Skoog Basal Medium pó, cultura de células vegetais SIGMA-ALDRICH testada COD: M5519-10L
9Frasco


20622/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1047/2019 Outras Compras
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Filme plástico para cobertura de estufa agrícola, com tratamento anti UV, transparente, bobina de 10 m x 60 m x 150 micras
Descrição: Filme plástico para cobertura de estufa agrícola, com tratamento anti UV, transparente, bobina de 10 m x 60 m x 150 micras
1Unidade
Produto/Serviço: Filme plástico para cobertura de estufa agrícola, com tratamento anti UV, transparente, bobina de 7,60 m x 105 m x 150 micras
Descrição: Filme plástico para cobertura de estufa agrícola, com tratamento anti UV, transparente, bobina de 7,60 x 105 m x 150 micras
2Unidade
Produto/Serviço: Filme plástico transparente para cobertura de estufa agrícola, com tratamento anti-uv, rolo com 12m X 60m X 150 micras,
Descrição: Filme plástico transparente para cobertura de estufa agrícola, com tratamento anti-uv, rolo com 12m X 60m X 150 micras
1Unidade
Produto/Serviço: Tela anti-inseto com tratamento anti uv, 3 m largura, rolo com 50 metros
Descrição: Tela anti-inseto com tratamento anti uv, 3 m largura, rolo com 50 metros
4Unidade
Produto/Serviço: Tela anti-inseto com tratamento anti uv, 1,5 m largura, rolo com 50 metros
Descrição: Tela anti-inseto com tratamento anti uv, 1,5 m largura, rolo com 50 metros
4Unidade


20631/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1048/2019 Material de Campo
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Bandeja de poliestireno expandido (isopor), para produção de mudas com 128 células
Descrição: Bandeja de poliestireno expandido (isopor), para produção de mudas com 128 células
50Unidade
Produto/Serviço: Bandeja de poliestireno expandido (isopor), para produção de mudas com 200 células
Descrição: Bandeja de poliestireno expandido (isopor), para produção de mudas com 200 células
50Unidade
Produto/Serviço: Bandeja de poliestireno expandido (isopor), para produção de mudas com 288 células
Descrição: Bandeja de poliestireno expandido (isopor), para produção de mudas com 288 células
50Unidade
Produto/Serviço: Fertilizante NPK, Fórmula: 05-20-10, saco de 50Kg, com no mínimo um ano de validade a contar da data de entrega
Descrição: Fertilizante NPK, Fórmula: 05-20-10, saco de 50Kg, com no mínimo um ano de validade a contar da data de entrega
10Saco
Produto/Serviço: Fertilizante NPK, Fórmula: 20-00-20, granulado, saco de 50Kg, com no mínimo um ano de validade a contar da data de entrega
Descrição: Fertilizante NPK, Fórmula: 20-00-20, granulado, saco de 50Kg, com no mínimo um ano de validade a contar da data de entrega
10Saco
Produto/Serviço: Fertilizante Termofosfato de Yoorim, saco de 40 kg, com no mínimo 15 meses de validade a contar da data de entrega.
Descrição: Fertilizante Termofosfato de Yoorim, saco de 40 kg, com no mínimo um ano de validade a contar da data de entrega
5Saco
Produto/Serviço: Fertilizante sulfato de amônio com no mínimo 20% de nitrogênio, saco de 50kg, com no mínimo 15 meses de validade a contar da data de entrega.
Descrição: Fertilizante sulfato de amônio com no mínimo de nitrogênio de 20%, saco de 50kg
5Saco
Produto/Serviço: Fita gotejadora de 16 mm com gotejadores espaçados de 20 cm, vazão média de 1.40 L/h a pressão de serviço de 1.0 kgf/cm2, parede 10 mil, bobina com 1.000 metros.
Descrição: Fita gotejadora de 16 mm com gotejadores espaçados de 20 cm, vazão média de 1.40 L/h a pressão de serviço de 1.0 kgf/cm2, parede 10 mil, bobina com 1.000 metros.
4Unidade
Produto/Serviço: Fertilizante liberação lenta 3 meses, granulometria padrão, 14-14-14 3M, com no mínimo 15 meses de validade a contar da data de entrega, balde com 15kg. Ref. Osmocote/FORTH COTE
Descrição: Fertilizante liberação lenta 3 meses, granulometria padrão, 14-14-14 3M, com no mínimo 15 meses de validade a contar da data de entrega, balde com 15kg. Ref. Osmocote/FORTH COTE
1Saco


20632/2019
22/07/2019 16:00:00
Cotação (Compra Direta)
CD 1049/2019 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Frasco para reagente
Descrição: Frascos de vidro para acondicionamento dos peixes. Os potes são das seguintes dimensões: - pote condimento (100ml), total de 5000 unidades, unidade no valor de R$ 1,40, total = R$ 7000,00; - pote azeitona 100g (218ml), total de 1000 unidades, unidade no valor de R$ 1,40, total = R$ 1400,00; - pote conserva 600ml, total de 500 unidades, unidade no valor de R$ 2,50, total = R$ 1250,00; - pote 3L boca larga 3250ml, total de 300 unidades, unidade no valor de R$ 9,00, total de R$ 2700,00 Total da compra = R$ 12.350,00 (6800 unidades)
6800Unidade